|
Methicillin-resistant Staphylococcus aureus in horses and horse personnel, 2000-2002
Methicillin-resistant Staphylococcus aureus (MRSA) infection was identified in 2 horses treated at a veterinary hospital in 2000, prompting a study of colonization rates of horses and associated persons. Seventy-nine horses and 27 persons colonized or infected with MRSA were identified from October 2000 to November 2002; most isolations occurred in a 3-month period in 2002. Twenty-seven (34%) of the equine isolates were from the veterinary hospital, while 41 (51%) were from 1 thoroughbred farm in Ontario. Seventeen (63%) of 27 human isolates were from the veterinary hospital, and 8 (30%) were from the thoroughbred farm. Thirteen (16%) horses and 1 (4%) person were clinically infected. Ninety-six percent of equine and 93% of human isolates were subtypes of Canadian epidemic MRSA-5, spa type 7 and possessed SCCmeclV. All tested isolates from clinical infections were negative for the Panton-Valentine leukocidin genes. Equine MRSA infection may be an important emerging zoonotic and veterinary disease.
Methicillin was first introduced in human medicine in the 1950s for the treatment of penicillin-resistant staphylococci, and within a few years, methicillin-resistant isolates of Staphylococcus aureus (MRSA) were identified (1). Since then, MRSA has emerged as an important problem in human medicine internationally, especially in the hospital setting (24). Methicillin resistance is mediated by production of an altered penicillin-binding protein (PBP2a), which confers resistance to all [beta]-lactam anti-microbial agents. The gene that encodes this altered PBP, mecA, resides on a large, mobile genetic element called the staphylococcal chromosomal cassette mec (SCCmec). Three types of SCC (types I, II, and III) were originally described in hospital-acquired MRSA strains, most of them isolated before 1990. A fourth type (type IV) was recently described, initially in community-acquired MRSA isolates (2-4). Although MRSA have been typically hospital acquired (5,6), reports of community-acquired MRSA in persons have increased (7-9). In Canada, 6 epidemic clones, designated CMRSA (Canadian epidemic MRSA) 1 through 6 based on pulsed-field gel electrophoresis (PFGE), are recognized (10,11). In addition to PFGE, SCCmec typing and DNA sequencing of the X region of the protein A gene (spa typing) can be used to further differentiate strains for epidemiologic analysis (12). The role of MRSA in veterinary medicine has not been well characterized. Isolation of MRSA has been reported in horses, cattle, and dogs (13-20). In addition, MRSA infection in 2 horses treated at the Ontario Veterinary College Veterinary Teaching Hospital (OVC-VTH) was first documented in 2000. To evaluate the apparent emergence of MRSA infection and colonization in horses, nasal swabs from horses and persons at OVC-VTH and a select group of farms from southern Ontario were cultured. Materials and Methods Veterinary Hospital Facility The Large Animal Clinic at OVC-VTH is a tertiary-care referral center with a caseload of [approximately equal to]2,000 horses per year. Hospital personnel that are in contact with horses include senior clinicians (internists, surgeons, other specialists), residents, interns, veterinary technicians, agricultural assistants, and veterinary students. Sampling Procedures A limited organized MRSA screening of horses at OVC-VTH was performed from October 1 to October 5, 2000, after the first 2 clinical cases were recognized. A more thorough screening program was performed from May 17 to November 16, 2002, after further cases were recognized. With this program, nasal swabs were collected from all horses at the time of admission, weekly during hospitalization, and at the time of discharge. Intermittent screening of horses on 1 Ontario breeding farm (farm A) was performed from May 11 to September 15, 2002, after infected horses were identified. Nasal swabs were collected from horses at 9 other Ontario farms after MRSA infection in a resident horse was identified at OVC-VTH. Nasal swabs were collected from all horses that were present on these farms on the day of sampling. Voluntary screening of OVC-VTH Large Animal Clinic personnel was performed on 2 occasions in 2002 in response to identification of clusters of nosocomial MRSA colonization in horses. Periodic nasal cultures of horses and personnel were initiated at farm A from May 11 to September 15, 2002. For persons, cotton-tipped swabs were used to sample both anterior nares. For horses, the swab was inserted = 10 cm into 1 anterior nare and rubbed against the mucosa as the swab was removed. Swabs were placed in liquid Stuart's or Amies medium and stored at 4[degrees]C until processing. Colonization or infection identified within 72 h of admission was classified as community acquired. MRSA Identification, Characterization, and Typing Nasal swab samples were injected onto mannitol-salt agar with 2 [micro]g/mL oxacillin and incubated aerobically at 35[degrees]C for 48 h. Colonies were identified as S. aureus based on colony morphology, Gram stain appearance, ability to ferment maltose, and positive tube coagulase test or latex agglutination test (Pastorex Staph Plus, Bio-Rad Laboratories Ltd, Mississauga, Canada). Screening for methicillin resistance in all S. aureus was by growth on Mueller-Hinton agar with 4% NaCl and 6 [micro]g/mL oxacillin. Confirmation of methicillin resistance was by detection of PBP 2a by using the MRSA SCREEN antibody kit (Denka Seiken Co. Ltd, Tokyo, Japan) (21). Antimicrobial susceptibility testing was performed by broth microdilution as per NCCLS guidelines (22). Detection of inducible erm gene-mediated clindamycin-resistance (MLSs phenotype) was performed by using the double disk diffusion method as described in M100-S14 NCCLS 2004 Informational Supplement (23). Isolates were typed by using PFGE after DNA extraction and SmaI digestion (24). PFGE images were read manually by 1 investigator (B.W.), and related isolates were divided into subtypes by using an arbitrary naming system based on previously described principles (25). Further typing by DNA sequence analysis of the X region of the protein A gene (spa typing) and SCCmec typing were performed, as has been described, on isolates from those with clinical infections, atypical isolates from colonized horses, and a random sample of isolates from colonized horses (12,26). Isolates from those with clinical infection were tested for the presence of the Panton-Valentine leukocidin (PVL) genes by polymerase chain reaction (PCR) and by molecular beacon with the lukF component of pvl. Amplification of the pvl gene was performed by using the following primers: LukS-PV: GGCCTTTCCAATACAATATTGG; and LukF-PV: CCCAATCAACTTCATAAATTG. Thermal cycling consisted of initial heating at 95[degrees]C for 5 min followed by 35 cycles of denaturation (1 min at 94[degrees]C), annealing (30 s at 57[degrees]C), and extension (1 min at 72[degrees]C). The beacon experiment was carried out using the following beacon and primers: lukF beacon: 5' 6-FAM d (CGCGAAGAATTTATTGGTGTCCTATCTCGATCGCG) DABCYL 3', LukF F: 5'-GCCAGTGTTATCCAGAGG-3', LukF R: CTATCCAGTTGAAGTTGATCC-3'. Quantitative real-time PCR mixture contained 1x I.Q. supermix (Bio-Rad Laboratories Ltd., Hercules, CA, USA), 0.1 [micro]mol/L each molecular beacon, 0.5 [micro]mol/L of each primer, and DNA template. The thermal cycling program consisted of 10 min on a spectrofluorometric thermal cycler at 95[degrees]C, followed by 45 cycles of 30 s at 95[degrees]C, 30 s at 50[degrees]C, and 30 s at 72[degrees]C. Statistical Analysis Duration of carriage by adult horses versus foals was compared by using the Mann-Whitney test. The incidence of intermittent MRSA shedding by adult horses and foals was compared by using Fisher exact test. A p value of <0.05 was considered significant for all comparisons. Results In total, MRSA was isolated from 79 horses and 27 persons. Two equine isolations occurred in 2000, 5 in 2001, and 72 in 2002. Of the 79 equine cases, 27 (34%) were in horses that had been hospitalized at OVC-VTH, 41 (52%) were from 1 thoroughbred farm (farm A), and 11 (14%) were from other Ontario farms. Twenty-four of the 79 (30%) horses were adults; the remaining 55 (70%) were <1 year of age. |
